View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_41 (Length: 246)
Name: NF9961_low_41
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 35914814 - 35914605
Alignment:
| Q |
18 |
aacaaggtcataacaagatcacgagaataacttgcgacgcatgattaatcaggttnnnnnnntggtaagttcaattggatgaataattgattctatatat |
117 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35914814 |
aacaaggtcataacaagatcacaaggataacttgcgacgc---------caggttaaaaaaatggtaagttcaattggatgaataattgattctatatat |
35914724 |
T |
|
| Q |
118 |
gattagcgacgatttcaaaatttcagacgtgatttaaactaaccatatccttaattgaattaatcataatttccatgacatttttcatataataaaacgg |
217 |
Q |
| |
|
||| ||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35914723 |
gatcagcaacgatttcaaaatttcagacgtgatttaaactaaacatatacttaattgaattaatcataatttccatgacatttttcatataataaaacgg |
35914624 |
T |
|
| Q |
218 |
tatcccttccttccctatg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35914623 |
tatcccttccttccctatg |
35914605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University