View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_43 (Length: 245)
Name: NF9961_low_43
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 1875827 - 1876055
Alignment:
| Q |
1 |
ggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcttttgtttgctggtcttgaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1875827 |
ggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcttttgtttgctggtcttgaactt |
1875926 |
T |
 |
| Q |
101 |
gctatgtgtgctagggatatgaatagcaaagaagattcctttgtggcacttatttgcactgctgtttcattggttggatcaagtgcagcacttggannnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
1875927 |
gctatgtgtgctagggatatgaatagcaaagaagattcctttgtggcacttatttgcactgctgtttcattggtgggatcaagtgcagcactaggatttt |
1876026 |
T |
 |
| Q |
201 |
nnngtggaatgattgtgtatttgcttctt |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1876027 |
tggttggaatgattgtgtatttgcttctt |
1876055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 1808223 - 1808418
Alignment:
| Q |
1 |
ggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcttttgtttgctggtcttgaactt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
1808223 |
ggtattgggattggttttaggaacttctttggcacacattttgcaacaatttccagttgggattttaggtgtgttacttttgtttgctggtattgaactt |
1808322 |
T |
 |
| Q |
101 |
gctatgtgtgctagggatatgaatagcaaagaagattcctttgtggcacttatttgcactgctgtttcattggttggatcaagtgcagcacttgga |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
1808323 |
gctatgtgtgctagggatatgaatagtaaagaagattcttttgtggcacttatttgcactgctgtttcattggttggatcaagtgctgctcttgga |
1808418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 25797989 - 25797794
Alignment:
| Q |
1 |
ggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcttttgtttgctggtcttgaactt |
100 |
Q |
| |
|
|||||| |||||| |||| |||||||| |||||| ||||||||| | |||||| || ||||| ||||| || ||||||||||||||||| |||||||| |
|
|
| T |
25797989 |
ggtattaggattgttgttgggaacttccttggcaaacattttaaagatgtttccggtcgggatcttaggagtgttgcttttgtttgctggaattgaactt |
25797890 |
T |
 |
| Q |
101 |
gctatgtgtgctagggatatgaatagcaaagaagattcctttgtggcacttatttgcactgctgtttcattggttggatcaagtgcagcacttgga |
196 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| ||||||||| ||||||| ||||||||||||| |||||||||||| |||| || ||||| |
|
|
| T |
25797889 |
gctatgtgtgctagagacatgaatagcaaagaagatttctttgtggctcttatttccactgctgtttcaatggttggatcaaatgcatcatttgga |
25797794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University