View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_56 (Length: 228)
Name: NF9961_low_56
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 3 - 218
Target Start/End: Complemental strand, 3307429 - 3307214
Alignment:
| Q |
3 |
tggacacatgtgataagagcatctacataccatgacctaactcatttttggtttcccaacttgtcaccaccactacccgcactctcataatcctcctccg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3307429 |
tggacacatgtgataagagcatctacataccatgacctaactcatttttggtttcccaacttgtcaccaccactacccacactctcataatcctcctccg |
3307330 |
T |
 |
| Q |
103 |
aggtaatctcatcttgaacggaatccttttttcccctttcttgtgacaattattcttgaagttattggtcttgtgacaattgaagcatttatactttgtt |
202 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307329 |
aggcaatctcatcttgaacggaatccttttttcccctttcttgtgacaattattcttgaagttattggtcttgtgacaattgaagcatttatactttgtt |
3307230 |
T |
 |
| Q |
203 |
ttttcattcccctttg |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3307229 |
ttttcattcccctttg |
3307214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 198
Target Start/End: Complemental strand, 16549635 - 16549593
Alignment:
| Q |
156 |
tcttgaagttattggtcttgtgacaattgaagcatttatactt |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16549635 |
tcttgaagtgattggtcttgtgacaattgaagcatttgtactt |
16549593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University