View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_57 (Length: 227)
Name: NF9961_low_57
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 28243540 - 28243653
Alignment:
| Q |
106 |
catttgatttttcctctaccatgggtaaagcttccgaagatagtaaatctgatttgttctgtataaagtggttgtagagctcagtttgttgtatcagaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28243540 |
catttgatttttcctctaccatgggtaaagcttccgaagatagtaaatctgatttgttctgtataaagtggctgtagagctcagtttgttgtatcagaaa |
28243639 |
T |
 |
| Q |
206 |
attaagcctttgct |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28243640 |
attaagcctttgct |
28243653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 28243186 - 28243294
Alignment:
| Q |
1 |
taacccaactgttctgctatttgaatgcttaaaaagttgttaatttttgaaccatgtagttgcatgg-cactaaacaaggttactttataggttgcaaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28243186 |
taacccaactgttctgctatttgaatgcttaaaaagttgttaatcattgaaccatgtagttgcatggccactaaacaaggttactttataggttgcaaaa |
28243285 |
T |
 |
| Q |
100 |
caattgcat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
28243286 |
taattgcat |
28243294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University