View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_58 (Length: 221)
Name: NF9961_low_58
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 205
Target Start/End: Complemental strand, 53701115 - 53700922
Alignment:
| Q |
12 |
aggagcagagatcgatggaaaatatgaatgatgaagaatcaaccgtgaaacaaggaagcggtggtggtgaaaatcatgtaagaagaacagaaagtgtgga |
111 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701115 |
aggaccagaaatcgatagaaaatatgaatgatgaagaatcaaccgtgaaacaaggagggggtggtggtgaaaatcatgtaagaagaacagaaagtgtgga |
53701016 |
T |
 |
| Q |
112 |
aacaccaacaacagacacatcttaagatcagaacgtttgatatgattaatcatgtttaatggagtttttgcatgttccgtaattggttattatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53701015 |
aacaccaacaacagacacatcttaagataagaacgtttgatatgattaatcatgtttaatggagtttttgcatgttccgtgattggttattatt |
53700922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University