View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_62 (Length: 215)
Name: NF9961_low_62
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_62 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 121 - 197
Target Start/End: Original strand, 5465582 - 5465658
Alignment:
| Q |
121 |
acatatgaatctatctaactaactctgtacttattcttcttttgttcacacaatacatagtattgcaaatgcatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465582 |
acatatgaatctatctaactaactctgtactaattcttcttttgttcacacaatacatagtattgcaaatgcatgat |
5465658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 5465478 - 5465531
Alignment:
| Q |
17 |
tggtcaactgttaacttcattcctcccataaaaagaggcctgcctgcccctaac |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465478 |
tggtcaactgttaacttcattcctcccataaaaagaggcctgcctgcccctaac |
5465531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University