View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9962_low_3 (Length: 287)
Name: NF9962_low_3
Description: NF9962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9962_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 271
Target Start/End: Complemental strand, 5387194 - 5386938
Alignment:
| Q |
15 |
gaggaatgagctggtcttgattggtataattatgtaacttgtaagaaaaacgaagtaagaattaattatatatgatccttatcttttggcaaacaaatgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5387194 |
gaggaatgagctggtcttgattggtataattatgtaacttgtaagaaaaacgaagtaagaattaagtatatatgatccttatcttttggcaaacaaatgt |
5387095 |
T |
 |
| Q |
115 |
tccttgtaaaatgtgttgtgcatgaaaatatttgtttgctatccaaagtaacatatctatccacaactactcactggaaataccagcagagcatcatcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5387094 |
tccttgtaaaatgtgttgtgcatgaaaatatttgtttgctatccaaagtaacatatttatccacaactagtcactggaaataccagcagagcatcatcaa |
5386995 |
T |
 |
| Q |
215 |
gtatggtctttgatatttttgcttaaatacgcgatgctgctctgctggtataataag |
271 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5386994 |
gtatgatctttgatatttttgcttaaatacgcgatgctgctttgctggtataataag |
5386938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University