View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9963_high_15 (Length: 256)
Name: NF9963_high_15
Description: NF9963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9963_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 26499494 - 26499726
Alignment:
| Q |
17 |
aaaaatctggtcaagtagcttttgaccactacaatctcaatattaggagcactaaccaaataaaacacttaatcttccttactttactgaaaatggcttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
26499494 |
aaaaatctggtcaagtagcttttgaccactacaatctcaatattaggaccattaaccaaataaaacacttaatcttccttacattagtgaaaatggcttc |
26499593 |
T |
 |
| Q |
117 |
taatggagagctatcacattcttatatgatctatagtgagtgaatgaatgcttgacaatataggctgctgcgtttgattttcaagcatatgcctatttag |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499594 |
taatggagagctatcacattctaatatgatctatagtgagtgaatgaatgcttgacaatataggctgctgcgtttgattttcaagcatatgcctatttag |
26499693 |
T |
 |
| Q |
217 |
accacatgagacacttttgtacccacacaattg |
249 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| |
|
|
| T |
26499694 |
accatatgagacacttttatacccacacaattg |
26499726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University