View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9963_low_20 (Length: 290)
Name: NF9963_low_20
Description: NF9963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9963_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 32730926 - 32730673
Alignment:
| Q |
19 |
taaggttggaagcagtggaagatccaagaaaggtgttgtagtggaagcaaaaattaaggtagccataaacggatttggaaggatcggacggaacttcttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730926 |
taaggttggaagcagtggaagatccaagaaaggtgttgtagtggaagcaaaaattaaggtagccataaacggatttggaaggatcggacggaacttcttg |
32730827 |
T |
|
| Q |
119 |
agatgttggcatggtcgtaaggactcgcctcttgacgtcattgccatcaacgacaccggaggtgtaaagcaagcctctcaccttctcaagtatgattcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730826 |
agatgttggcatggtcgtaaggactcgcctcttgacgtcattgccatcaacgacaccggaggtgtaaagcaagcctctcaccttctcaagtatgattcca |
32730727 |
T |
|
| Q |
219 |
cacttggaatctttgatgctgatgttaaacctgttggcactgatggtatctctg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730726 |
cacttggaatctttgatgctgatgttaaacctgttggcactgatggtatctctg |
32730673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University