View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9965_high_4 (Length: 270)
Name: NF9965_high_4
Description: NF9965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9965_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 253
Target Start/End: Original strand, 40742017 - 40742265
Alignment:
| Q |
6 |
acctcgttcttgactgaagttgatctgttcgactactaaaattgttagcatgaataaatgtatttatggcaacaaaatcaattgagatttt-ccaccaaa |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||| |
|
|
| T |
40742017 |
acctcgttcttgaccgaagttgatctgttcgactactaaaattgttagcatgaataaatgtatctatggcaacaaaatcaattgagatttttccgccaag |
40742116 |
T |
|
| Q |
105 |
tcaacctttgttgcccagatttttcggtagaccagcttttgtcatcatgcattgcatgtgttctatgttggaaatgaagtttaagaccaattgattcttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40742117 |
tcaacctttgttgcccagatttttcgatagaccagcttttgtcatcatgcatttcatgtgttctatgttggaaatgaagtttaagaccaattgattcttc |
40742216 |
T |
|
| Q |
205 |
ttttatgttctaaaatcatgtatggtatatcaaaagtggtatttggttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40742217 |
ttttatgttctaaaatcatgtatggtatatcaaaagtggtatttggttt |
40742265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University