View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9966_high_3 (Length: 340)
Name: NF9966_high_3
Description: NF9966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9966_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 15 - 330
Target Start/End: Complemental strand, 33079693 - 33079377
Alignment:
| Q |
15 |
agttttgaagttggagaagtt-gaagcaagcatggttagataatataaatgcttttgaccagcttcaaatctaggttggtaaattggaggaaacagtgac |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33079693 |
agttttgaagttggagaagtttgaagcaagcatggttagataatagaaatgcttttgaccagcttcaaatctaggttggtaaattggaggaaacagtgac |
33079594 |
T |
|
| Q |
114 |
tgagaaattggaaactataagtgatttggagaacaaaaatagaaaattggcggatgaaaagcgcaaagttgagaccttgcttgagtttttgaacacgaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33079593 |
tgagaaattggaaactataagtgatttggagaacaaaaatagaaaattggcggatgaaaagcgcaaagttgagacctcacttgagtttttgaacacgaag |
33079494 |
T |
|
| Q |
214 |
ttcaaagtattgcatggaagtgttgcacggttggaggaggattccaaacttttggtgagcttagctgcctctggtcgaggaaacaatgacggtgagcctc |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33079493 |
ttcaaagtattgcatgaaagtgttgcacggttggaggatgattccaaacttttggtgaacttagctgcctctggtcgaggaaacaatgacggggagcctc |
33079394 |
T |
|
| Q |
314 |
ctgctgctgaacctatg |
330 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33079393 |
ctgctgctgaacctatg |
33079377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 183 - 302
Target Start/End: Complemental strand, 41519251 - 41519132
Alignment:
| Q |
183 |
tgagaccttgcttgagtttttgaacacgaagttcaaagtattgcatggaagtgttgcacggttggaggaggattccaaacttttggtgagcttagctgcc |
282 |
Q |
| |
|
||||| ||| || |||| |||||||| ||||| |||| ||| |||| ||| |||||| |||||||||| |||||||| |||| |||| ||| |||| |
|
|
| T |
41519251 |
tgagatcttactcgagtctttgaacaaaaagtttaaagcatttcatgaaagagttgcaaggttggaggatgattccaacctttcaatgagtgtagatgcc |
41519152 |
T |
|
| Q |
283 |
tctggtcgaggaaacaatga |
302 |
Q |
| |
|
|||||| | ||||||||||| |
|
|
| T |
41519151 |
tctggtggtggaaacaatga |
41519132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University