View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9966_high_6 (Length: 295)
Name: NF9966_high_6
Description: NF9966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9966_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 10233499 - 10233312
Alignment:
| Q |
1 |
ttcactaaattgtttatcaatgatgacatgcctgagatcaatatgttcagggaaaggttagttacccttaatcaatcatgtgtttttcttttgtattctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10233499 |
ttcactaaattgtttatcaatgatgacatgcctgagatcaacatgttcagggaaaggttggttacccttaatcaatcatgtgtttttcttttgtattctg |
10233400 |
T |
|
| Q |
101 |
tctataatcgttgtcgtaactgagtagcatatggttatatacctattttcaatagtttgcctaaagatgaccagaccatgtctcagag |
188 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
10233399 |
tctataatcgttgtcgtaactgactagcatatggttatatacctattttcaatagtttgcctaaagatgaccagactatgtcttagag |
10233312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University