View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9966_high_7 (Length: 276)
Name: NF9966_high_7
Description: NF9966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9966_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 20498107 - 20498170
Alignment:
| Q |
19 |
ggatatctataaataaatatcgtggccgtgaaccatggccacaaagattgtttcagtttgatga |
82 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20498107 |
ggatatctataaataaatattgtggccgtgaaccatggccacaaagattgtttcagtttgatga |
20498170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 259
Target Start/End: Original strand, 20498286 - 20498346
Alignment:
| Q |
199 |
gcagtaggcaacatatgattgggttgtttggaggtgtcaacctagttggaatgtttgcgtt |
259 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
20498286 |
gcagtaggcagcatatgattaggttgtttggagatgtcaacctagttgggatgtttgcgtt |
20498346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University