View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9966_low_13 (Length: 229)
Name: NF9966_low_13
Description: NF9966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9966_low_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 6690643 - 6690421
Alignment:
| Q |
7 |
aaagcgtcattcctttgcaatttttgtttgcaggaactgatgatcctcttggtaagaaattgaacaactcaaaaacacgccaagaagttgggtgggagcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6690643 |
aaagcgtcattcctttgcaatttttgtttgcaggaactgatgatcctcttggtaagaaattgaacaactcaaaaacacgccaagaagttgggtgggagcc |
6690544 |
T |
 |
| Q |
107 |
caagtactctagctttgctcatttccttgagaccctatgagcaacttttgagtgaaatctttggaggtgaaatcaaatctaatcaatattgtcaccatga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6690543 |
aaagtactctagctttgctcatttccttgagaccctatgagcaacttttgagtgaaatctttggaggtgaaatcaaatctaatcaatattgtcaccatga |
6690444 |
T |
 |
| Q |
207 |
tgacattgtaaataaaatattat |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6690443 |
tgacattgtaaataaaatattat |
6690421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 130
Target Start/End: Complemental strand, 38874006 - 38873918
Alignment:
| Q |
42 |
actgatgatcctcttggtaagaaattgaacaactcaaaaacacgccaagaagttgggtgggagcccaagtactctagctttgctcattt |
130 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||| ||| ||| || || ||||| || |||||||| ||||| |||| ||||||||||| |
|
|
| T |
38874006 |
actgatggccctcttggtaagagattaaacaacacaagaactcgacaggaagtcggctgggagcctcagtaccctagttttgctcattt |
38873918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University