View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9967_high_3 (Length: 271)
Name: NF9967_high_3
Description: NF9967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9967_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 97 - 255
Target Start/End: Original strand, 44189289 - 44189447
Alignment:
| Q |
97 |
gcttagataacatatatattattctccaaaattaatttcagggagagatttagacatgacgaatattgtattcagtattctccctaaacttcctattgag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44189289 |
gcttagataacatatatattattctccaaaattaatttcagagagagatttagacatgacgaatattgtattcagtattctccctaaacttcctattgag |
44189388 |
T |
 |
| Q |
197 |
cctctcaaccaatttactaatggtttgaacttaactacattatgcttgtgatatgtatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44189389 |
cctctcaaccaatttactaatggtttgaacttaactacattatgcttgtgatatgtatg |
44189447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University