View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9967_low_6 (Length: 251)
Name: NF9967_low_6
Description: NF9967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9967_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 16087675 - 16087805
Alignment:
| Q |
1 |
aagtaatccacatctaataaaatatttctatttgttaatttcatgttaacttgtctcaaacacattttgctcaaaataatagtttaaaaaaccaagatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16087675 |
aagtaatccacatctaataaaatatttctatttgttaatttcacgttaacttgtctcaaacacattttgctcaaaataatagtt--aaaaaccaagatca |
16087772 |
T |
 |
| Q |
101 |
caatttgaacggtagaaattttaaaatcaacacaa |
135 |
Q |
| |
|
||||||| | |||||||| |||||||||||||||| |
|
|
| T |
16087773 |
caatttg-atggtagaaa-tttaaaatcaacacaa |
16087805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 38643161 - 38643343
Alignment:
| Q |
1 |
aagtaatccacatctaataaaatatttctatttgttaatttcatgttaacttgtctcaaacacattttgctcaaaataatagtttaaaaaaccaagatca |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| || |||| |||||| ||| |||| |||||| |||||||||||| ||||||||||| | | ||||| |
|
|
| T |
38643161 |
aagtattccacatctaataaaatatttcaatctgtttatttcactataatttgtttcaaacgtattttgctcaaagtaatagtttaagagatcaagagtg |
38643260 |
T |
 |
| Q |
101 |
caatttgaacggtagaaa----ttttaaaatcaacacaaaagtccatcttcattaataacaagctatcgtgatcataacaaca |
179 |
Q |
| |
|
|||||| || |||||||| ||||||||| | |||||||||||||||||||| || ||| ||||||| || |||| |||| |
|
|
| T |
38643261 |
caattttaatggtagaaaacagatttaaaatccatacaaaagtccatcttcattactaccaaactatcgtaataataataaca |
38643343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University