View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9968_high_2 (Length: 405)
Name: NF9968_high_2
Description: NF9968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9968_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 38589417 - 38589680
Alignment:
| Q |
1 |
cagcttgcattgtgatggctaataatagttaaggcatatggagcatttttcagtccttagacattcttctaagtcgtccttcattcttgcaaaaccgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589417 |
cagcttgcattgtgatggctaataatagttaaggcatatggagcatttttcagtccttagacattcttctaagtcgtccttcattcttgcaaaaccgcag |
38589516 |
T |
|
| Q |
101 |
gatcattcgtggttgatgaacttgaatggcttgttaccgttaattgagatgttaagggtcagttatgggttaaccacacaatgatgtttatattatgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589517 |
gatcattcgtggttgatgaacttgaatggcttgttaccgttaattgagatgttaagggtcagttatgggttaaccacacaatgatgtttatattatgata |
38589616 |
T |
|
| Q |
201 |
tcttaaggagtgaatggtaactattgatacaaatcaactctgcacttataataataataagtcc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589617 |
tcttaaggagtgaatggtaactattgatacaaatcaactctgcacttataataataataagtcc |
38589680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 335 - 393
Target Start/End: Original strand, 38589751 - 38589809
Alignment:
| Q |
335 |
tgcactttattatgaggtgcaccgatgcattgcaaattatttttgtccaccttggcctt |
393 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589751 |
tgcactttattatgaggtgcaccaatgcattgcaaattatttttgtccaccttggcctt |
38589809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University