View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9968_low_9 (Length: 234)
Name: NF9968_low_9
Description: NF9968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9968_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 5714757 - 5714551
Alignment:
| Q |
12 |
cacagaagaaaattttatgagcagcattataaatgttttcgtgtttgtgtcagttgtgtgcagctcatattacacttatatatgcatacattattgttgc |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
5714757 |
cacagaagaaaattttatgagcaacattataaatgttttcgtgtttgtgtcagttgtgtgcagctcatattacacttatatatgcatgcattattgttac |
5714658 |
T |
 |
| Q |
112 |
ttacttgatatcccaatcattatacacatatactttaaaattcatacttactctagaaggactaaagcttgcagctgcaattggtgctccaagcactgtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714657 |
ttacttgatatcccaatcattatacacatatactttaaaattcacacttactctagaaggactaaagcttgcagctgcaattggtgctccaagcactgtg |
5714558 |
T |
 |
| Q |
212 |
aacactg |
218 |
Q |
| |
|
||||||| |
|
|
| T |
5714557 |
aacactg |
5714551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University