View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_high_15 (Length: 261)
Name: NF9971_high_15
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_high_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 64 - 261
Target Start/End: Complemental strand, 17354892 - 17354695
Alignment:
| Q |
64 |
tgatgcaaaatatttatgaacttctattatttgtgcagagctatgtctactattcattcaattttcataacaactatgtcattatacatggtgttttgct |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17354892 |
tgatgcaaaatatttatgaacttctattatttgtgcagagctatgtctactattcattcaattttcataacaactatgtcattatacatggtgttttgct |
17354793 |
T |
|
| Q |
164 |
caaatttattttctgacaaccagtctaccgatcctattacagttcgaagctcttcactgtcaacatttacactgggggtaagaatggtctcatttttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
17354792 |
caaatttattttctgacaaccagtctaccgatcctattacagttcgaagctcttcactgtcaacatttgcactgggggtaagaatggtcacatttttt |
17354695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 85 - 179
Target Start/End: Complemental strand, 39440936 - 39440842
Alignment:
| Q |
85 |
ttctattatttgtgcagagctatgtctactattcattcaattttcataacaactatgtcattatacatggtgttttgctcaaatttattttctga |
179 |
Q |
| |
|
||||||| | || |||| |||||||| ||||| ||||| ||||| |||||||||||||| || ||| ||||||||||||||||| ||| |||||| |
|
|
| T |
39440936 |
ttctattttctgcgcagtgctatgtcaactatccattccatttttataacaactatgtctttgtacttggtgttttgctcaaatctatattctga |
39440842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University