View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_high_22 (Length: 204)
Name: NF9971_high_22
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 1024697 - 1024536
Alignment:
| Q |
20 |
aacatgaccaactccattggtaagacaggtttgctcaaatggggtgtaacatttttaaatgacacaacattttgataccgatagcacaatctttgctacc |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1024697 |
aacatgaccaactccattggtaggacaggtttgctcaaatggggtgtaacatttttaaatgacacaacattttgataccgatagcacaatctttgctacc |
1024598 |
T |
 |
| Q |
120 |
acatgcatgttaaaattaatggcgagtttggcagaaccacaatgtgttagtgtgattttggc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1024597 |
acatgcatgttaaaattaatggcgagtttggcagaaccacaatgtgttagtgtgattttggc |
1024536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University