View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_high_24 (Length: 203)
Name: NF9971_high_24
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 2524394 - 2524260
Alignment:
| Q |
20 |
tgttgaaacacagccgggactctattcaaccctctccctcctttctgtccttctctcttctctaataatttgatttacacatgaatgtctgtcgacctca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2524394 |
tgttgaaacacagccgggactctattcaaccctctccctcctttctgtccttctctcttctctaataatttgatttacacatgaatgtctgtcgacctca |
2524295 |
T |
 |
| Q |
120 |
tgtgttggtcgacatctctcgacgtgtatgccact |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2524294 |
tgtgttggtcgacatctctcgacgtgtatgccact |
2524260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University