View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9971_high_24 (Length: 203)

Name: NF9971_high_24
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9971_high_24
NF9971_high_24
[»] chr3 (1 HSPs)
chr3 (20-154)||(2524260-2524394)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 2524394 - 2524260
Alignment:
20 tgttgaaacacagccgggactctattcaaccctctccctcctttctgtccttctctcttctctaataatttgatttacacatgaatgtctgtcgacctca 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2524394 tgttgaaacacagccgggactctattcaaccctctccctcctttctgtccttctctcttctctaataatttgatttacacatgaatgtctgtcgacctca 2524295  T
120 tgtgttggtcgacatctctcgacgtgtatgccact 154  Q
    |||||||||||||||||||||||||||||||||||    
2524294 tgtgttggtcgacatctctcgacgtgtatgccact 2524260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University