View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_low_13 (Length: 366)
Name: NF9971_low_13
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 19310237 - 19310578
Alignment:
| Q |
1 |
ttggataactataagaaagtgaataagcaggttgatgatgaaactgataaggaacctatagtcaagaagtaagtgaataaagtctcctaatcaggtttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19310237 |
ttggataactataagaaagtgaataagcaggttgatgatcaaactgataaggaacctatagtcaagaagtaagtgaataa-gtctcctaatcaggtttac |
19310335 |
T |
 |
| Q |
101 |
atgaaacttagggatggtagaattcagaaagaaacaataaggaggtgttgcagactgaaggaactgagaaagcaaacaataactcagttaacttgtagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19310336 |
atgaaacttagggatggtagaattcagaaagaaacaataaggaggtgttgcagactgaaggaactgagaaagcaaacaataattcagttaacttgtagag |
19310435 |
T |
 |
| Q |
201 |
caagcaaactgatttatacaaaggcgaaaaccccacaacaggtgtaattccagcagctcaggctattgctggatccagtgacacaactcatttacagaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19310436 |
caagcaaactgatttatacaaaggcgaaaaccctacaacaggtgtaattccagcagctcaggctattgctggatccagtgacacaactcatttacagaat |
19310535 |
T |
 |
| Q |
301 |
cttgaagttcaaaacaattttgaatcactgctattagacgatg |
343 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19310536 |
cttaaagttcaaaacaattttgaatcactgctattagacgatg |
19310578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University