View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_low_2 (Length: 545)
Name: NF9971_low_2
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-28; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 96 - 191
Target Start/End: Complemental strand, 2318609 - 2318512
Alignment:
| Q |
96 |
taataaaattgatgaaattatgcagagcagaaagttgcagtttaagg---aaaacaaaaactataaacagctcctagtcaatgaactacgtactatgac |
191 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2318609 |
taatcaaattcatgaaattatgcagagaagaaagttgcagtttaaggcacaaaacaaaaactataaacagctcctagtcaat-aactacgtactatgac |
2318512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 110 - 226
Target Start/End: Complemental strand, 2323219 - 2323104
Alignment:
| Q |
110 |
aaattatgcagagcagaaagttgcagtttaagg---aaaacaaaaactataaacagctcctagtcaatgaactacgtactatgacagcccgtcttgccct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||| |||||||| |||||| || ||| |
|
|
| T |
2323219 |
aaattatgcagagcagaaagttgcagtttaaggcacaaagcaaaaactataaacagctcctagtgaatgaac----aactatgacttcccgtcatgtcct |
2323124 |
T |
|
| Q |
207 |
ctgaaggttgcattgtaatt |
226 |
Q |
| |
|
| |||||| ||||||||||| |
|
|
| T |
2323123 |
ccgaaggtagcattgtaatt |
2323104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 2318798 - 2318746
Alignment:
| Q |
24 |
accacacagcagtgcctgtggctcgagaccaactgctcaccatctaatgtctc |
76 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2318798 |
accacacagcagcgcctgtggctcgataccaactgctcagcatctaatgtctc |
2318746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 339 - 403
Target Start/End: Complemental strand, 17175558 - 17175493
Alignment:
| Q |
339 |
atttggtgggattatttacctttgttttttaggaat-attttttaagagatagtcatggacttcca |
403 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||| || |||||| ||||||||||| ||||||||| |
|
|
| T |
17175558 |
atttggggggattatttacccttgtttcttagggatgttttttttagagatagtcacggacttcca |
17175493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University