View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_low_22 (Length: 242)
Name: NF9971_low_22
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 51530802 - 51531025
Alignment:
| Q |
1 |
tggtgaagaagaatctttttgaagtagtcctcagcaacgatcaacttgcaactgctacctccgaagatagatttccttcgtggattaactacggagacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51530802 |
tggtgaagaagaatctttttgaagtagtcctcagcaacgatcaacttgcaactgctacctccgaagatagatttccttcgtggattaacgacggagacaa |
51530901 |
T |
|
| Q |
101 |
gaagttttttgaggcaaatgaaacgactgctgatgctattgtggcggctgatgggagtgggaactacactacggtgatggatgccgtattggcagcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51530902 |
gaagttttttgaggcaaatgaaacgactgctgatgctattgtggcggctgatgggagtgggaactacactacagtgatggatgccgtattggcagcacct |
51531001 |
T |
|
| Q |
201 |
aaattcagcatgagaagatatgtt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51531002 |
aaattcagcatgagaagatatgtt |
51531025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 51524734 - 51524828
Alignment:
| Q |
129 |
gctgatgctattgtggcggctgatgggagtgggaactacactacggtgatggatgccgtattggcagcacctaaattcagcatgagaagatatgt |
223 |
Q |
| |
|
||||||||| ||||||| |||||||| ||||| ||||| ||| ||||||||||||||||| |||||||||| || |||||||| ||||||||| |
|
|
| T |
51524734 |
gctgatgctgttgtggctgctgatggaagtggagactacgctaaggtgatggatgccgtatcggcagcacctgaaagcagcatgaaaagatatgt |
51524828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University