View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_low_23 (Length: 238)
Name: NF9971_low_23
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 16 - 147
Target Start/End: Original strand, 49437877 - 49438008
Alignment:
| Q |
16 |
ataagctcaccctgttggcctatgaaattctgaaatatgcaagttttgaggtgtagtgaaaggcattgcggaacaaattttgggtcctcccaatttttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49437877 |
ataagctcaccctgttggcctatgaaattctgaaatatgcaagttttgaggtgtagtgaaaggcattgcggaacaaattttgggtccttccaatttttct |
49437976 |
T |
|
| Q |
116 |
ggacatgtagtcttctatcaatagtcgagccc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49437977 |
ggacatgtagtcttctatcaatagtcgagccc |
49438008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 17641196 - 17641278
Alignment:
| Q |
30 |
ttggcctatgaaattctgaaatatgcaagttttgaggtgtagtgaaaggcattgcggaacaaattttgggtcctcccaatttt |
112 |
Q |
| |
|
|||||||||||| || ||| | ||||| |||| ||||||| ||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17641196 |
ttggcctatgaagtttagaactttgcaaattttaaggtgtaatgaaaaacattgcggaacaaatattgggtccacccaatttt |
17641278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 37419428 - 37419392
Alignment:
| Q |
72 |
tgaaaggcattgcggaacaaattttgggtcctcccaa |
108 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
37419428 |
tgaaaggcattccggaacaatttttgggtcctcccaa |
37419392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University