View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9971_low_24 (Length: 238)
Name: NF9971_low_24
Description: NF9971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9971_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 23589369 - 23589575
Alignment:
| Q |
13 |
tttggtgtttgtttgtagttgataattggtgcaattgacttttgtgggccctgggtttggatcagattttgaaggggaattcaataaccaccctcttcag |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
23589369 |
tttggtgtttgtttgaagttgataattggtgcaattgacttttgtgggcccttggtttggttcagaatttgaaggggaattcaatgaccaccctcttcag |
23589468 |
T |
|
| Q |
113 |
tttgcttttacttctcaaatccaagtgcaagcgaataaaatttaaagagatggaaatataagtgtttgtaataagtttatttgtattggtagataaaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23589469 |
tttgcttttacttctcaaatccaagtgcaagcgaataaaatttaaagagatggaaatataagtgtttgtaataagtttatttgtgttggtagataaaata |
23589568 |
T |
|
| Q |
213 |
agcatag |
219 |
Q |
| |
|
||||||| |
|
|
| T |
23589569 |
agcatag |
23589575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University