View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9972_low_11 (Length: 201)
Name: NF9972_low_11
Description: NF9972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9972_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 7899403 - 7899240
Alignment:
| Q |
19 |
tgaatagcagcatgttgatagatgggatttttgccagggctagctggttccacagaagacacaaatacgtttgaacctactactaaatttgatgggtttt |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7899403 |
tgaatagcagcatgttggtagatgggatttttgccagggct----ggtgccacagaagacacaaatacgtttgaacctactactaaatttgatgggttgt |
7899308 |
T |
|
| Q |
119 |
tgttgcttacgaatttccatcattgggaaaagtatttttatgattttgttgcttgaattggttatgtt |
186 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899307 |
tgttgcttatgaatttccataatagggaaaagtatttttatgattttgttgcttgaattggttatgtt |
7899240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 96 - 144
Target Start/End: Complemental strand, 7883787 - 7883740
Alignment:
| Q |
96 |
tactactaaatttgatgggtttttgttgcttacgaatttccatcattgg |
144 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
7883787 |
tactactaaatttgatgggtttt-gttgcttatgaatttccatcattgg |
7883740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University