View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9972_low_9 (Length: 245)
Name: NF9972_low_9
Description: NF9972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9972_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 8641689 - 8641898
Alignment:
| Q |
20 |
cttataccaaattatctagtttctctttattgtttagtatctgacttcactctttatttattctgcagaatgcatatataaaaggaccggcgccacaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8641689 |
cttataccaaattatctagtttctctttattgtttagtatctgacttcactctttatttattctgcagaatgcatatataaaaggaccggcgccacaaaa |
8641788 |
T |
|
| Q |
120 |
agaagctgctcctggtcttgcatactttcacatccccttgccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaaaatggaaatggatggc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
8641789 |
agaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaaaatggaaacatatagc |
8641888 |
T |
|
| Q |
220 |
ggtgatggca |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
8641889 |
ggtgatggca |
8641898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 8648269 - 8648478
Alignment:
| Q |
20 |
cttataccaaattatctagtttctctttattgtttagtatctgacttcactctttatttattctgcagaatgcatatataaaaggaccggcgccacaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8648269 |
cttataccaaattatctagtttctctttattgtttagtatctgacttcactctttatttattctgcagaatgcatatataaaaggaccggcgccacaaaa |
8648368 |
T |
|
| Q |
120 |
agaagctgctcctggtcttgcatactttcacatccccttgccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaaaatggaaatggatggc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
8648369 |
agaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaaaatggaaacatatagc |
8648468 |
T |
|
| Q |
220 |
ggtgatggca |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
8648469 |
ggtgatggca |
8648478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University