View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9974_low_5 (Length: 250)
Name: NF9974_low_5
Description: NF9974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9974_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 19344362 - 19344187
Alignment:
| Q |
13 |
gagaaggcacagttgtataatatcccatctttttcaaatatctttccatcttgctcatgcaatttggtatctttgtagacccctctcttcccataaagct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344362 |
gagaaggcacagttgtataatatcccatctttttcaaatatctttccatcttgctcatgcaatttggtatctttgtagacccctctcttcccataaagct |
19344263 |
T |
 |
| Q |
113 |
tgagctgttaacaatcaccaaattttatcaaacagtcacaagggaagggacctgtatttcttctataaaataatga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19344262 |
tgagctgttaacaatcaccaaattttatcaaacagtcaaaagggaagggacctatatttcttctataaaataatga |
19344187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 250
Target Start/End: Complemental strand, 19344152 - 19344101
Alignment:
| Q |
199 |
agtatgagagagtagattatgtacttctgctgagagtgattcaatagcctcc |
250 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344152 |
agtatgaaagagtaaattatgtacttctgctgagagtgattcaatagcctcc |
19344101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University