View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9975_high_3 (Length: 228)
Name: NF9975_high_3
Description: NF9975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9975_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 131 - 223
Target Start/End: Complemental strand, 29642444 - 29642352
Alignment:
| Q |
131 |
ctaaacactttggatgtagccatattgaatttcaatttgaaagtgtaatatttaaaggaaaaacgacgagcagtttatgaaatacaaaaaagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||| |||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
29642444 |
ctaaacactttggatgtagccatattgaatttcaattcgaaagtgtgatacttaaggtaaaaactacgagcagtttatgaaatacaaaaaagt |
29642352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 29642574 - 29642508
Alignment:
| Q |
1 |
cataatcagctattaaatttgtaatattaggataaatttgaggatggtctcagtctggaaatatttc |
67 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29642574 |
cataatcaactactaattttgtaatattaggataatattgatgatggtctcagtctggaaatatttc |
29642508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University