View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9977_high_2 (Length: 255)
Name: NF9977_high_2
Description: NF9977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9977_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 45687928 - 45688103
Alignment:
| Q |
1 |
tcatcagcaaataggaggagggagatgtgaagggcattccttgagaatttgaataggatgtcaattaccgctattggcagtttcacaaatagagttaaag |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45687928 |
tcatcaggaaataggaggagggagatgtgaagggcattccttgaga-tttgaataggatgtcaattaccgctattggcagtttcacaaatagagataaag |
45688026 |
T |
|
| Q |
101 |
agttttcctataaatacaaaggatgaagagatataaacagagcatatttccttgcctaatgcacgccatgagtcatcttaa |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45688027 |
agttttcctata----caaaggatgaagagatataaacagagcatatttccttgcctaatgcatgccatgagtcatcttaa |
45688103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University