View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9978_high_7 (Length: 249)
Name: NF9978_high_7
Description: NF9978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9978_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 46894490 - 46894243
Alignment:
| Q |
1 |
cataccaagcaccctattgccattcaacccaatgctccagagccaatgctcacacgtgtcacacgtgtgtctcttctttcagacccggttgccataacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894490 |
cataccaagcaccctattgccattcaacccaatgctccagagccaatgctcacacatgtcacacgtgtgtctcttctttcagacccggttgccataacaa |
46894391 |
T |
 |
| Q |
101 |
cacctgtgggcttatgtccgcaaacccggtcactcaacaaacagctatgggtgaactggctcaagatgtcctcgctatctacgccattaacgggcctaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46894390 |
cacctgtgggcttatgtccgcaaacccggtcactcaacaaacagctatgggtgaactggctcaagatgtcctcgctatctacgccattaatgggcctaag |
46894291 |
T |
 |
| Q |
201 |
cccggcccaatggttacaatccctcggttcctcttctctgctgctcct |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
46894290 |
cccggcccaatggttacaatccctcagttcctcttctcttgtgctcct |
46894243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University