View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9978_high_8 (Length: 247)
Name: NF9978_high_8
Description: NF9978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9978_high_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 26992811 - 26993045
Alignment:
| Q |
13 |
agcagagaatagcaatttcgtccaacctaccatacctagatttgatagtccattatgatcattggtctatgttgatggaaaagcgcttgagatcgaaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26992811 |
agcagagaatagcaatttcgtccaacctaccatacctagatttgatagtccattatgatcattggtctatgttgatggaaaagcgcttgagatcgaaaga |
26992910 |
T |
|
| Q |
113 |
gtattggagcttggtggagagcgggattccaaaagtagtcgtgggagttaaaccaattgcgcttggcttgcttctctttcctccttggcatttggtttgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26992911 |
gtattggagcttggtggagagcgggattccaaaagtagtcgtgggagttaaaccaattgcgcttggcttgcttctctttcctccttggcatttggtttgc |
26993010 |
T |
|
| Q |
213 |
aaaaattttggagtacttgttcactttcttttatg |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26993011 |
aaaaattttggagtatttgttcactttcttttatg |
26993045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 144
Target Start/End: Complemental strand, 1755524 - 1755394
Alignment:
| Q |
13 |
agcagagaatagcaatttcgtccaacctaccatacctagatttgatagtccattatgatcattggtctatgttgatggaaaagcgcttgagatcgaaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| ||| | ||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
1755524 |
agcagagaatagcaatttcgtccaacctgccataccttgatttgatggtc-actatgatcattggtctatgttgatggaaaatctcttgagatcgaaaga |
1755426 |
T |
|
| Q |
113 |
gtattggagcttggtggagagcgggattccaa |
144 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
1755425 |
gtattggagcttggtggagagcgagattccaa |
1755394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 124
Target Start/End: Original strand, 12793831 - 12793938
Alignment:
| Q |
16 |
agagaatagcaatttcgtccaacctaccatacctagatttgatagtccattatgatcattggtctatgttgatggaaaagcgcttgagatcgaaagagta |
115 |
Q |
| |
|
|||||||| |||||| || |||||| ||||||||||||| ||| ||| ||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
12793831 |
agagaataacaattttgttcaacctgccatacctagattcgatggtc-attatgatcattggtctatgttgatggaaaatctcttgagatcgaaagagta |
12793929 |
T |
|
| Q |
116 |
ttggagctt |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
12793930 |
ctggagctt |
12793938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University