View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9978_low_11 (Length: 249)
Name: NF9978_low_11
Description: NF9978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9978_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 249
Target Start/End: Complemental strand, 39369702 - 39369468
Alignment:
| Q |
15 |
gggcaaacaagtgcagaactaggttaccacttaccacctagtggggatataatcatccagagtattgaatcttcaaccattttgatatgccagtataacg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39369702 |
gggcaaacaagtgcagaactaggttaccacttaccacctagtggggatataatcatccagagtattgaatcttcaaccattttgatatgccagtgtaacg |
39369603 |
T |
|
| Q |
115 |
ttaaagttgaggcgctaatggaattggagtcaatggctcaggaagcacgttacgttgtggctataggtaaggcctgatcctaatggattttgatagataa |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39369602 |
ttaaagtcgaggcgctaatggaattggagtcaatggctcaggaaacacgttacgttgtggctataggtaaggcctgatcctaatagattttgatagataa |
39369503 |
T |
|
| Q |
215 |
agtttggtannnnnnnngagcaatgatattttgac |
249 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
39369502 |
agtttggtattttttttgagcaatgatattttgac |
39369468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University