View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9978_low_5 (Length: 293)
Name: NF9978_low_5
Description: NF9978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9978_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 121 - 281
Target Start/End: Complemental strand, 5849729 - 5849569
Alignment:
| Q |
121 |
atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagcttctagagg-ttctcacttcttacccctcccct |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5849729 |
atgcatttcttaaccaac-ccatgactcagcacatggtgactcatagcagagatattatctagaagcttctagagggttctcacttcttacccctcccct |
5849631 |
T |
|
| Q |
220 |
tgagaggtgtcatcacaaagtccttgaagtgttgaggtttgaccaagttcctcttagccctt |
281 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5849630 |
tgggaggtgtcatcacaaagtccttgaagcgttgaggtttgaccaagtttctcttagccctt |
5849569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 121 - 281
Target Start/End: Complemental strand, 5843693 - 5843533
Alignment:
| Q |
121 |
atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagcttctagagg-ttctcacttcttacccctcccct |
219 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5843693 |
atgcatttcttaaccagc-ccatgactcagcacatggtgactcatagcagagatattatctagaagcttctagagggttctcacttcttacccctcccct |
5843595 |
T |
|
| Q |
220 |
tgagaggtgtcatcacaaagtccttgaagtgttgaggtttgaccaagttcctcttagccctt |
281 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5843594 |
tgggaggtgtcatcacaaagtccttgaagcgttgaggtttgaccaagtttctcttagccctt |
5843533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 32605572 - 32605508
Alignment:
| Q |
19 |
atttgacatggttcaaggtcttgctggaatgactctaaaatgactcataaacaccaataaaaaca |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605572 |
atttgacatggttcaaggtcttgctggaatgactctaaaatgactcataaacaccaataaaaaca |
32605508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University