View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9979_high_11 (Length: 255)
Name: NF9979_high_11
Description: NF9979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9979_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42162350 - 42162231
Alignment:
| Q |
35 |
ccttcaaatcaaccaaggcttcacctgcaatgcctttaatcaacctcctacagcacgcaaacccacgaaaccttacatgatgcaatcattatttagaaca |
134 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||||| |
|
|
| T |
42162350 |
ccttcaaatccaccaaggcttcacctgcaatgcctttaatcaacctcctacagcacgcaaacccaagaaaccctacatgatgcaatcaatgtttagaaca |
42162251 |
T |
|
| Q |
135 |
ttattaaatattcgagtcaa |
154 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
42162250 |
ttataaaatattcgagtcaa |
42162231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University