View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9979_high_3 (Length: 356)
Name: NF9979_high_3
Description: NF9979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9979_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 61 - 138
Target Start/End: Complemental strand, 30369200 - 30369123
Alignment:
| Q |
61 |
ataggacaaggtttgaatgtttaaattcaattggtcctctctgaaagtttttgtcttaactccttagattggtttaga |
138 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30369200 |
atagaacaaggtttgaatgtttaaattcaattggtcctctctgaaagtttttgtcttaactccttagattggtttaga |
30369123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 31386096 - 31386007
Alignment:
| Q |
33 |
aagtattttaaactgaataatcaatcatataggacaaggtttgaatgtttaaattcaattggtcctctctgaaagtttttgtcttaactcctta |
126 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||| |||||||||||| || |||||||||| | |||||||| |||| |
|
|
| T |
31386096 |
aagtatcttaaactgaataatca----tataggacaagatttgaatgtttgaattcaattggttatccctgaaagtttatctcttaacttctta |
31386007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 56 - 136
Target Start/End: Complemental strand, 20997979 - 20997899
Alignment:
| Q |
56 |
atcatataggacaaggtttgaatgtttaaattcaattggtcctctctgaaagtttttgtcttaactccttagattggttta |
136 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| || || |||||| | ||||||| ||||| ||| ||||| |
|
|
| T |
20997979 |
atcatataggacaaggtttgaatggtagaattcaattggtcatccctaaaagttcatctcttaacaccttacattagttta |
20997899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University