View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9979_high_9 (Length: 296)
Name: NF9979_high_9
Description: NF9979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9979_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 7 - 284
Target Start/End: Original strand, 10032368 - 10032645
Alignment:
| Q |
7 |
aattcatcgcgtaaaacggtgaaagtacggttctcgtgtggcggtcctcaggtgcttccgtcaagctttgaaaacgatggtaaggttatggtgaagaccg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032368 |
aattcatcgcgtaaaacggtgaaagtacggttctcgtgtggcggtcctcaggtgcttccgtcaagctttgaaaacgatggtaaggttatggtgaagaccg |
10032467 |
T |
|
| Q |
107 |
ggagtaatggttctggttccggtcttagttttgacggtgcagatgaaaagattaatgggaatgtgggaaggaggaaagatgtttataggctggaggaatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032468 |
ggagtaatggttctggttccggtcttagttttgacggtgcagatgaaaagattaatgggaatgtgggaaggaggaaagatgtttataggctggaggaatt |
10032567 |
T |
|
| Q |
207 |
tactttgggtgatattgtttgggcgaaatgcgggaagaggtttccggcttggcccggtgtggtgattgatcctctctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032568 |
tactttgggtgatattgtttgggcgaaatgcgggaagaggtttccggcttggcccggtgtggtgattgatcctctctc |
10032645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 279
Target Start/End: Complemental strand, 48487208 - 48487139
Alignment:
| Q |
210 |
tttgggtgatattgtttgggcgaaatgcgggaagaggtttccggcttggcccggtgtggtgattgatcct |
279 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||| |||||||| ||||| | ||| || ||||||||| |
|
|
| T |
48487208 |
tttgggtgatattgtttgggcaaaatgtggcaagacttttccggcatggcctgctgttgtcattgatcct |
48487139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University