View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_12 (Length: 440)
Name: NF9980_low_12
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 53 - 266
Target Start/End: Original strand, 52418886 - 52419095
Alignment:
| Q |
53 |
aggattgtcattttatagtcaagtatcaacttgaattttaaattttatttgtattggatagcagtgataatcaaaagagaatttaatgttagaagagaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52418886 |
aggattgtcattttatagtcaagtatcaacttgaattttaaattttatttgtattggatagcagtgataatcaaaagagaatttaatgttagaagagaaa |
52418985 |
T |
|
| Q |
153 |
tgactcaagaaagatttcctacatagcgagattcacattctcaaatctacttcttcctggctggtcagttaatggctacagtcaaacctacacaaatgga |
252 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52418986 |
tgactc----aagatttcctacatagcgagattcacattctcaaatctacttcttcctggctggtcagttaatggctacagccaaacctacacaaatgga |
52419081 |
T |
|
| Q |
253 |
agatgagatttagg |
266 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52419082 |
agatgagatttagg |
52419095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 355 - 399
Target Start/End: Original strand, 52419217 - 52419261
Alignment:
| Q |
355 |
ttggaaggatcgaattccaagacttgccggacccattcattcatt |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52419217 |
ttggaaggatcgaattccaagacttgccggacccattcattcatt |
52419261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 52417078 - 52417122
Alignment:
| Q |
172 |
tacatagcgagattcacattctcaaatctacttcttcctggctgg |
216 |
Q |
| |
|
||||| ||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
52417078 |
tacatggcgagcttcacattctcaaatctgcttctacctggctgg |
52417122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University