View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_33 (Length: 265)
Name: NF9980_low_33
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 36 - 261
Target Start/End: Original strand, 43003211 - 43003437
Alignment:
| Q |
36 |
tgaaatttcttgtaccataacgaagaatattttcctcctattagatattaatcatataacgtgc-tgatatctttatttgaattgaagttgaagcttaga |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43003211 |
tgaaatttcttgtaccataacgaagaatattttcctcctattagatattaatcatataacgtgcgtgatatctttatttggattgaagttgaagcttaga |
43003310 |
T |
 |
| Q |
135 |
gatccaatgaatttaagccagtcatagggtcaacctagttatccnnnnnnnttatcttatggtcaaaccaatattgcacaatgtggcatgttcttagaat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003311 |
gatccaatgaatttaagccagtcatagggtcaacctagttatccaaaaaaattatcttatggtcaaaccaatattgcacaatgtggcatgttcttagaat |
43003410 |
T |
 |
| Q |
235 |
agccaacatcccatttgctaaacccta |
261 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43003411 |
agccaacatcccatttgctaaacccta |
43003437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University