View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_38 (Length: 246)
Name: NF9980_low_38
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 46084741 - 46084513
Alignment:
| Q |
1 |
tctgagatcttttaccatgcggtaaggctgtatcatagataaaatagttaatgtaatgatcagaaagtcaaaatctagcaagaatagaggtgaaatgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46084741 |
tctgagatcttttaccatgcggtaaggctgtatcatagataaaatagttaatgtaatgatcagaaagtcaaaatctagcaagaatagaggtgaaatgtac |
46084642 |
T |
|
| Q |
101 |
aatctcaaacctacatggagcacataactacgaatctgactaccccaggttatgtcagtaagagactgtgtatgctgagcattcaactgcgcctggcgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46084641 |
aatctcaaacctacatggagcacataactacgaatctgactaccccaggttatgtcagtaagagactgtgtatgctgagcattcaactgcgcctggcgag |
46084542 |
T |
|
| Q |
201 |
ccatctcaatctggtttaatcttgactga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46084541 |
ccatctcaatctggtttaatcttgactga |
46084513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University