View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_42 (Length: 239)
Name: NF9980_low_42
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 7269789 - 7269605
Alignment:
| Q |
1 |
ttattaatccaacataggatttacatagtaaaactcgatataacttatcagtaaactctgagtcatacctaacaacaacctgtgattttcttcttggcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
7269789 |
ttattaatccaacataggatttacatagtaaaactcggtataacttatcagtaaactatgagtcatatctaacaacaacatgtgattttcttcttggcac |
7269690 |
T |
|
| Q |
101 |
aaaagaacaaaaccatatccaagttcaagagaagataacacaatttaaaccatgtattgtgattttactctgcattcttcactca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
7269689 |
aaaagaacaaaaccatatccaagttcaagagaagataacacaatttaaaccatgtattgtgattctactatgcattcttcactca |
7269605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University