View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_48 (Length: 221)
Name: NF9980_low_48
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 6066838 - 6067041
Alignment:
| Q |
1 |
tatcaaaccgcgaatcagcgcgtcgttcacgcatgaggaagcagaaacaccttgatgagctttggtcacaagttctttggctaaggaatgaaaatcatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6066838 |
tatcaaaccgcgaatcagcgcgtcgttcacgcatgaggaagcagaaacaccttgatgagctttggtcacaagttctttggctaaggaatgaaaatcatca |
6066937 |
T |
 |
| Q |
101 |
acttatagagaaacttaaccatgtttctgagaatcatgatcaagttgttcaagagaatgctcagcttaaagaagaagctttggaacttcgacaaatgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6066938 |
acttatagagaaacttaaccatgtttctgagaatcatgatcaagttgttcaagagaatgctcagcttaaagaagaagctttggaacttcgacaaatgata |
6067037 |
T |
 |
| Q |
201 |
aaag |
204 |
Q |
| |
|
|||| |
|
|
| T |
6067038 |
aaag |
6067041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 33 - 197
Target Start/End: Original strand, 5744864 - 5745028
Alignment:
| Q |
33 |
atgaggaagcagaaacaccttgatgagctttggtcacaagttctttggctaaggaatgaaaatcatcaacttatagagaaacttaaccatgtttctgaga |
132 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| | |||| || || ||| || | | ||||| |
|
|
| T |
5744864 |
atgaggaaacaaaaacagcttgatgagctttggtcacaagttgtttggctaaggaatgaaaatcatcaattactagataagctcaacaatttctgtgaga |
5744963 |
T |
 |
| Q |
133 |
atcatgatcaagttgttcaagagaatgctcagcttaaagaagaagctttggaacttcgacaaatg |
197 |
Q |
| |
|
||||||| ||||||| |||||||||| ||| | |||||| |||||| |||||||||||||||| |
|
|
| T |
5744964 |
ctcatgataaagttgtccaagagaatgttcaattgaaagaacaagcttcggaacttcgacaaatg |
5745028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University