View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9980_low_51 (Length: 216)
Name: NF9980_low_51
Description: NF9980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9980_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 34 - 202
Target Start/End: Original strand, 34831626 - 34831794
Alignment:
| Q |
34 |
tactgtagttgcaaacacgacaaaaattgagttcgtgatttagaatgtggtgatgaaacnnnnnnnaatatcttgattagaatcttgtttttcttttaaa |
133 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
34831626 |
tactgtagttgcaaacacgaaaaaaattgagttcgtgatttagaatgtggtgatgaaactttttttgatatcttgattagaatcttgtttttcttttgaa |
34831725 |
T |
 |
| Q |
134 |
gtagatgttgaacaatatacaaatgaaaagatttatatgttcaatgtctaagattttgtgtgaagatgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34831726 |
gtagatgttgaacaatatacaaatgaaaagatttatatgttcaatgtctaagattttgtgtgaaaatgt |
34831794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University