View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_high_12 (Length: 247)
Name: NF9981_high_12
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 45102097 - 45101868
Alignment:
| Q |
1 |
gtagtattcaaaatggagtagatgttaagcaaacatgttgaactataatctcttatatataatgtcatgaatcagagtacgaatctctattgagagagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45102097 |
gtagtattcaaaatggagtagatgttaaacaaacatgttgaactataatctcttatatacaatgtcatgaatcagagtacgaatctctattgagagagat |
45101998 |
T |
 |
| Q |
101 |
gtctatatatcatatttgatagtgtctcgaataaaattatctctaataaaaggaatgaaatcatattctcaactttaa-nnnnnnnnatcacatttacgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45101997 |
gtctatatatcatatttgatagtgtcttgaataaaattatctctaataaaaggaatgaaatcatattctcaactttaatttttttttatcgcatttacgt |
45101898 |
T |
 |
| Q |
200 |
atttggcacatttgctctcgtgggatcatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45101897 |
atttggcacatttgctctcgtgggatcatg |
45101868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University