View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_high_14 (Length: 243)
Name: NF9981_high_14
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 10 - 188
Target Start/End: Original strand, 9980287 - 9980459
Alignment:
| Q |
10 |
ggagaagcaaaggctaaaaaaggatgcatgacgggcactacagggctgttgatgggcgtcactacccccaaccatcacacacacaacataacataaatta |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
9980287 |
ggagaagaaaaggctaaaaaaggatgcatgacgggcactacagggctgttgatgggcgtcactacccc-aaccatcacacacacaaca-----taaatta |
9980380 |
T |
|
| Q |
110 |
agggagtacttgaaatggtcagcgacggtctgcccgtcacagggtgtgacgcccgtcattgacccataagccaattttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9980381 |
agggagtacttgaaatggtcagcaacggtctgcccgtcacagggtgtgacgcccgtcattgacccggaagccaattttt |
9980459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University