View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_high_6 (Length: 291)
Name: NF9981_high_6
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 21 - 277
Target Start/End: Original strand, 4878786 - 4879039
Alignment:
| Q |
21 |
agaggacctagcagaatgcttgctactaatgataatcaagtaactccacaaacagagaattcaggtcaacaatcacctaattgtcagccaaatggtttgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4878786 |
agaggacctagcagaatgcttgctactaatgataatcaagtaactccacaaacagagaattcaggtcaacaatcacctaattgtcagccaaatagtttgc |
4878885 |
T |
|
| Q |
121 |
aaggttcaagttcatgtcttgccagtcctcagttaaatcaaggaaggccttgtgaacctttaaacagagtatcatatccttactgcaagtgaacaatatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4878886 |
aaggttcaagttcatgtcttgccagtcctcagttaaatcaaggaagaccttgcgaacctttaaacagag---catatccttactgcaagtgaacaatatg |
4878982 |
T |
|
| Q |
221 |
gtttactgtgactcaattatttgtcttccattaaatggtttccatatttctattttc |
277 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4878983 |
gtttattgtgactcaattatttgtcttccattaaatggtttccgtatttctattttc |
4879039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University