View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_low_12 (Length: 291)
Name: NF9981_low_12
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 7589303 - 7589455
Alignment:
| Q |
1 |
gcagtggcattccttaattctttcagactctctgcttctcgtgggtaaacgctggtttccagtatatactgaccacaaaacttttggttaattaagcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7589303 |
gcagtggcattccttaattctttcagactctctggttctcgtgggtaaacgctggtttccagtatatactgatcacaaaacttttggttaattaagcaaa |
7589402 |
T |
|
| Q |
101 |
taggattgatcaatttatttaattgaagccaactaattagaaaactataagcc |
153 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589403 |
taggattgaacaatttatttaattgaagccaactaattagaaaactataagcc |
7589455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 180 - 285
Target Start/End: Original strand, 7589485 - 7589590
Alignment:
| Q |
180 |
cgaaccttggtcaaattcccactctgcaatataccatcgtatttacttgctaagttttccatctctctcaatttatttttagacttgcaacacctcccca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589485 |
cgaaccttggtcaaattcccactctgcaatataccatcgtatttacttgctaagttttccatctctctcaatttatttttagacttgcaacacctcccca |
7589584 |
T |
|
| Q |
280 |
acttcg |
285 |
Q |
| |
|
|||||| |
|
|
| T |
7589585 |
acttcg |
7589590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 42830022 - 42829944
Alignment:
| Q |
19 |
tctttcagactctctgcttctcgtgggtaaacgctggtttccagtatatactgaccacaaaacttttggttaattaagca |
98 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||| | | |||||||||||| |
|
|
| T |
42830022 |
tctttgagagtctctgcttctcgtgggtaaacgctggtttctagtatatactg-ccacaaaattgtatgttaattaagca |
42829944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University