View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_low_15 (Length: 280)
Name: NF9981_low_15
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 5 - 269
Target Start/End: Complemental strand, 11588150 - 11587887
Alignment:
| Q |
5 |
gaggagcagagagaatcgaattttcagatttttgtttcaatttttcttataaaatatttgagattaaaccctaaatccttttggatgtgatatagattct |
104 |
Q |
| |
|
||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11588150 |
gaggaccatagagaatcgaattttcagatttt-gtttcaatttttcttataaaatatttgagattcaaccctaaatccttttggatgtgatatagattct |
11588052 |
T |
 |
| Q |
105 |
tggaattcatcctgaagataatgcaaagttggatacagttgctgaagcatccatgttaattatgtcaatcatggataaacacattggtccattgaaaagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11588051 |
cggaattcatcctgaagataatgcaaagttggatacagttgctgaagcatccatgttaattatgtcaatcatggataaacacattggtccattgaaaagc |
11587952 |
T |
 |
| Q |
205 |
tgtaatattcgacatttaggtatgagttgtgtcaatggagatgttgtgcgatggatgaagaaact |
269 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11587951 |
tgtaatattcggcatttaggtatgagttgtgtcaatggagatgttgtgcggtggatgaagaaact |
11587887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 11581852 - 11581762
Alignment:
| Q |
18 |
aatcgaattttcagatttttgtttcaatttttcttataaaatatttgagattaaaccctaaatccttttggatgtgatatagattcttggaa |
109 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||| ||||||||| ||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11581852 |
aatcgaatttccagattttgttttca-tttttctaataaaatatctgagattcatttctaaatccttttcgatgtgatatagattcttggaa |
11581762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University