View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9981_low_17 (Length: 272)

Name: NF9981_low_17
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9981_low_17
NF9981_low_17
[»] chr3 (1 HSPs)
chr3 (18-261)||(42979989-42980232)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 42980232 - 42979989
Alignment:
18 accaatcacatctctctcaggtaataacaatctccactctcttcaatctcttcaaatcacatcaaaaccctaattattgattaatttatgaaaccctaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42980232 accaatcacatctctctcaggtaataacaatctccactctcttcaatctcttcaaatcacatcaaaaccctaattattgattaatttatgaaaccctaat 42980133  T
118 tatgcttcactaggttccgctcctcaccccagccactgtcagatacgtgaaacccaatactcttgttcggtttcgtggtatgattcaggatatgcttgga 217  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42980132 tatgcttcactaggttccgcttctcaccccagccactgtcagatacgtgaaaccctatactcttgttcggtttcgtggtatgattcaggatatgcttgga 42980033  T
218 aatgaattttatgttggcgcttttaaggtagtttttctgttcat 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
42980032 aatgaattttatgttggcgcttttaaggtagtttttctgttcat 42979989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University